View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_8 (Length: 502)
Name: NF20553_high_8
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 16 - 488
Target Start/End: Original strand, 26257641 - 26258115
Alignment:
| Q |
16 |
cataaaaaagtcaatagtcatgacaagaaagactaaagcatatgatagcttttattttgaagtagaaaacagaaggtaaattccaatgtcagtagcagat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26257641 |
cataaaaaagtcaatagtcatgacaagaaagactaaagcatataatagcttttattttgaagtagaaaacagaaggtaaattccaatgtcagtagccgat |
26257740 |
T |
 |
| Q |
116 |
tttatgccaaaaagaaagttactttttgtccaaagtaagtgcatgtttgaattggctgcaaatgaaaccttgcgcgtatccttctgcatatgcttgtgca |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26257741 |
tttttgccaaaaagaaagttactttttgtccaaagtaagggcatgtttgaattggctgcaaatgaaaccttgcgcgtatccttctgcatatgcttgtgca |
26257840 |
T |
 |
| Q |
216 |
catccttgcgcgtatgctcgtgcatagccttgagcatatgcttgcgtgtttgcttgtgtatagccttttgcatttgcttgcgcatatgtgcgtgcatatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
26257841 |
catccttgcgcgtatgctcgtgcatagccttgagcatatgcttgcgcgtttgcttgttcatagccttttgcatttgcttgcgcatatgcacgtgcatagc |
26257940 |
T |
 |
| Q |
316 |
ctttctcatatgcttgtgcataggctttctcatatgcattgcttttttctggcttcatcttgttctcctcattattgttctggtctccctctttctgatc |
415 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26257941 |
ctttctcatatgcttgtatataggctttctcatatgcattgcttttttctggcttcatcttgttctcctcattattgttctggtctccctctttctgatc |
26258040 |
T |
 |
| Q |
416 |
nnnnnnnnnnngctcctcattgtgtgaatctttcaaatgtttgtaact---atcatcattccatggacatgctgcc |
488 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26258041 |
-ttttttttttgctcgtcattgtgtgaatctttcaaatgtttgtaactatcatcatcattccatggacatgctgcc |
26258115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University