View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_23 (Length: 379)
Name: NF20553_low_23
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 69 - 379
Target Start/End: Original strand, 47562234 - 47562546
Alignment:
| Q |
69 |
ttgttgatgacttttcattgaacaattcgtaatccaattgcacaaaaattctctagcaatgtcttgacttagatgaattcactaaaataaattatttttc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||| |
|
|
| T |
47562234 |
ttgttgatgacttttcattgaacaattcgtaatccaattgcacaaaaattctctagcaatgtcttgacttagatgaattcactaaaaaaaaaaaaatttc |
47562333 |
T |
 |
| Q |
169 |
tcttgattttatttctaatgcttaaagggcagaagtttgttgtgtttctttttccatatgattttaatttatctatttgaagatacactagattatttaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47562334 |
tcttgattttatttctaatgcttaaagggcagaagtttgttgtgtttctttttccgtatgattttaatttatctatttgaagatacactagattatttaa |
47562433 |
T |
 |
| Q |
269 |
caaaaatatgagtcaatacttaccaaaatctaagcggtccattga--atcactaaacctttacaaatggttcgccattgttagagttttcaacctgcttt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47562434 |
caaaaatatgagtcaatacttaccaaaatctaaacggtccattgaatatcactaaacctttacaaatggttcaccattgttagagttttcaacctgcttt |
47562533 |
T |
 |
| Q |
367 |
tctccagattgtt |
379 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47562534 |
tctccagattgtt |
47562546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University