View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_31 (Length: 331)
Name: NF20553_low_31
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 23 - 309
Target Start/End: Original strand, 37969083 - 37969369
Alignment:
| Q |
23 |
ggccgcgcccaccatgacaatatgtacatcgttcaatttccaaaggatcaagtctaccgcgttccaccaagtgaaaatgcattcatcgttgaaagttatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969083 |
ggccgcgcccaccatgacaatatgtacatcgttcaatttccaaaggatcaagtctaccgcgttccaccaagtgaaaatgcattcatcgttgaaagttatc |
37969182 |
T |
|
| Q |
123 |
gtaatactaccaaggataagnnnnnnnnnnnncaacgtggttgttgttgccctcgattcttgctcaccattgttttaatccttgttacaatcgttgccgt |
222 |
Q |
| |
|
| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37969183 |
gcaatactaccaatgataagaaaaagaaaaaacaacgtggttgttgttgccctcgattcttgctcaccattgttttaatccttgttacaatcgttgctgt |
37969282 |
T |
|
| Q |
223 |
tgttggaataacattagccacattgttctttgttttcaacccagagggacccacatttactattacccgctttgaggtaaaaaacgt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969283 |
tgttggaataacattagccacattgttctttgttttcaacccagagggacccacatttactattacccgctttgaggtaaaaaacgt |
37969369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University