View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_32 (Length: 318)
Name: NF20553_low_32
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 19910772 - 19910563
Alignment:
| Q |
11 |
ttattctatagttaataaaagcattcgtgaattttccgcgaagaaagaattcacgggataaagcattttccttttggaattcttattgtccaatctctgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19910772 |
ttattctatagttaataaaagcattcgtgaattttccgcgaagaaagaattcgcgagataaagcattttccttttggaattcttattgtccaatctctgt |
19910673 |
T |
 |
| Q |
111 |
ttgcatggtactgcttatgcattttacttgaatttatgagtttgcatgatatacataaagtgataagattgtgaggaacaagtaaattccatctcctgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
19910672 |
ttgcatggtactgcttatgcattttacttgaa---atgagtttgcatggtatacataaagtgataagattgtgaggaacaagtaaattccagctactgct |
19910576 |
T |
 |
| Q |
211 |
tatgcattcataa |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19910575 |
tatgcattcataa |
19910563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 23602099 - 23602047
Alignment:
| Q |
26 |
taaaagcattcgtgaattttccgcgaagaaagaattcacgggataaagcattt |
78 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
23602099 |
taaaagcatttgtgaattttccgcgaagaatgaattcgcgagataaagcattt |
23602047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University