View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_33 (Length: 318)
Name: NF20553_low_33
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 62 - 300
Target Start/End: Original strand, 4724392 - 4724629
Alignment:
| Q |
62 |
catagattactacaatattttagaactcatgttgtatccttgcttagtacagtagtgtgtaaccttttgtctctaatccaggccttctacttggattacc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
4724392 |
catagattactacaatattttagaactcatgttgtatccttgcttagtacagtattgtgtaaccttttgcctctaatccaggccttctgcttggattacc |
4724491 |
T |
 |
| Q |
162 |
ggcagttaaaaaataaactatcatattaactaattactatatatatccaagattttaaattataaaatggccctaccactgcaaatttagccaaatctac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
4724492 |
ggcagttaaaaaataaactatcatattaactaattactatatatatccaagattttaaattataaaatgaccctaccattgcaaatttagccaaatctac |
4724591 |
T |
 |
| Q |
262 |
ccctaaactcttgcaatctataaaatattaacctatttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4724592 |
ccctaaactcttgcaatctataaaatatt-acctatttc |
4724629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University