View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_41 (Length: 266)
Name: NF20553_low_41
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 12635471 - 12635702
Alignment:
| Q |
18 |
tgaatggaaagagggtatgatgtttattggaacctgaaggggagcactgcttttatgatggtaattacaaagctcattggtatttactgcattggaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635471 |
tgaatggaaagagggtatgatgtttattggaacctgaaggggagcactgcttttatgatggtaattacaaagctcattggtatttactgcattggaaaca |
12635570 |
T |
 |
| Q |
118 |
cgccagtcattataacatatggaatggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcatcttcaatttcctaccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635571 |
cgccagtcattataacatatggaatggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcatcttcaatttcctaccaa |
12635670 |
T |
 |
| Q |
218 |
gagaaatccttattaatttatcttctttcctct |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
12635671 |
gag-aatccttattaatttatcttctttcctct |
12635702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 143 - 200
Target Start/End: Original strand, 38511200 - 38511257
Alignment:
| Q |
143 |
ggttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaaatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38511200 |
ggttgagattagcatagattgaaatcaacggccaccaaacattggcgcccaaaatcat |
38511257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 195
Target Start/End: Original strand, 37222948 - 37222999
Alignment:
| Q |
144 |
gttgagattagcatagattgaaatcaacggccaccatacattggcgcccaaa |
195 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| || ||||||||||||||| |
|
|
| T |
37222948 |
gttgagattagcataaattgaaattaacggccatcaaacattggcgcccaaa |
37222999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University