View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_50 (Length: 241)
Name: NF20553_low_50
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 16240397 - 16240472
Alignment:
| Q |
1 |
aactattgtatttgttactatgatcacccttgaattgctcccaatccttataaattgaaataatacgtacaataaa |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16240397 |
aactattgtatttgttactatgatcacccttgaattgctcccaatccttataaattgaaataatacgtacaataaa |
16240472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 16240546 - 16240621
Alignment:
| Q |
150 |
tcattcacgttgaaattcagtattagatctaaatgtaaactataaacaggaataagattataggagcacaatcttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16240546 |
tcattcacgttgaaattcagtattagatctaattgtaaactataaacaggaataagattataggagcacaatcttt |
16240621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University