View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20553_low_54 (Length: 237)

Name: NF20553_low_54
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20553_low_54
NF20553_low_54
[»] chr3 (1 HSPs)
chr3 (1-221)||(1154628-1154849)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1154849 - 1154628
Alignment:
1 ttgggaaagattaggtactttcttggcgttg-aagtaattcaaaatactgatggcattttccattagtcaaaaaagatatgtgatggaagtattggaaag 99  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||    
1154849 ttgggaaagattaggtactttcttggcgttggaagtaattcaaaagactgatggcatttttcattagtcaaaaaagatatgtgatggaagtattggagag 1154750  T
100 atttggaatggacaaaagcaattctgtccactatccaactgctcttggacagaagcttcgaaaggatcatgatggcatgaagattgatagtacttactaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1154749 atttggaatggacaaaagcaattctgtccactatccaactgctcttggacagaagcttcgaaaggatcatgatggcatgaagattgatagtacttactaa 1154650  T
200 acatcttttcttatcacaatag 221  Q
    ||||||||||||||||||||||    
1154649 acatcttttcttatcacaatag 1154628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University