View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_59 (Length: 227)
Name: NF20553_low_59
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_59 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 105 - 227
Target Start/End: Original strand, 40454242 - 40454364
Alignment:
| Q |
105 |
atgttataattctgatttcttcgcttataagaaacatgtacactttaaacttttaattgtattccgaccacactttaaacttcgagcgtagcaacttttt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
40454242 |
atgttataattctgatttcttcgcttataagaaacatacacaatttaaacttttaattgtattccaaccacactttaaacttcgagcatagcaatttttt |
40454341 |
T |
 |
| Q |
205 |
gtgtgaattatagatacagcaaa |
227 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
40454342 |
gtgtgaattatagatacaacaaa |
40454364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 40453956 - 40454028
Alignment:
| Q |
1 |
aaataaagttcaatgtannnnnnnnactaaaaaattcaatacatttacatgtgaattaatataatacaaatta |
73 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40453956 |
aaataaagttcaatgtattttttttactaaaaaattcaatacatttacatgtgaattaatataatacaaatta |
40454028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University