View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_60 (Length: 225)
Name: NF20553_low_60
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_60 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 27365209 - 27365440
Alignment:
| Q |
1 |
tatttctcacttgtcactctaggattgtttttcttggatgagatgatgaaactcctcttaaatccttaggagaaaaatgtggcttagaaaatttaagagg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27365209 |
tatttctcactagtcactctaggattgtttttcttggatgagatgatgaaactcctcttaaatccttaggagaaaaatgtggcttagaaaatttaagagg |
27365308 |
T |
|
| Q |
101 |
ggtggtagataatcaatgctttgattacaagactcttgtaactctcatcttcacattgtttt-------aggtttgaatgtgtgtgtagtctcaaggttc |
193 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27365309 |
ggtggtagataatcaatgcttagattacaagactcttgtaactctcatcttcacattgttttaggtttgaggtttgaatgtgtgtgtagtctcaaggttc |
27365408 |
T |
|
| Q |
194 |
aaggaaggaattcaaagaccttggaatgttca |
225 |
Q |
| |
|
|| ||||||||||||||| |||||||||||| |
|
|
| T |
27365409 |
aaagaaggaattcaaagattttggaatgttca |
27365440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 79 - 207
Target Start/End: Original strand, 35875152 - 35875276
Alignment:
| Q |
79 |
gtggcttagaaaatttaagaggggtggtagataatcaatgctttgatt-acaagactcttgtaactctcatcttcacattgttttaggtttgaatgtgtg |
177 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||| |||||| |||| ||||||||||| ||||||||||||||| ||| || |||||||||| || |
|
|
| T |
35875152 |
gtggcttagaaaattcgagagagatggtagataatcgatgcttagatttacaagactcttataactctcatcttcatatt-ttctaggtttgaa----tg |
35875246 |
T |
|
| Q |
178 |
tgtagtctcaaggttcaaggaaggaattca |
207 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |
|
|
| T |
35875247 |
tgtagtttcaaggttcaaagaaggaattca |
35875276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 215
Target Start/End: Complemental strand, 34071338 - 34071299
Alignment:
| Q |
176 |
tgtgtagtctcaaggttcaaggaaggaattcaaagacctt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
34071338 |
tgtgtagtctcaaggttcaaagaaggaattcaaaaacctt |
34071299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University