View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_61 (Length: 223)
Name: NF20553_low_61
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_61 |
 |  |
|
| [»] scaffold0127 (1 HSPs) |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0127 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 53 - 223
Target Start/End: Complemental strand, 22452 - 22282
Alignment:
| Q |
53 |
accctgatctgaactctctctaactttaatatcttcgccacccttctaattcaaataccttctattctaaaaataatggtggctggtggtgcgaagatgg |
152 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22452 |
accctgatctgaactctctctaactttcatatcttcgccacccttctaattcaaataccttctattctaaaaataatggtggctggtggtgcgaagatgg |
22353 |
T |
 |
| Q |
153 |
aacatccatccgcatcagctccggtccttgttctctcggcggtgatttcgcaggaaggttgtgttcatggc |
223 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
22352 |
aacatccatccgcatcacctccagtccttgttctcttggcggtgatttcgccggaaggctgtgttcatggc |
22282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 53 - 223
Target Start/End: Original strand, 5745416 - 5745586
Alignment:
| Q |
53 |
accctgatctgaactctctctaactttaatatcttcgccacccttctaattcaaataccttctattctaaaaataatggtggctggtggtgcgaagatgg |
152 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5745416 |
accccgatctgaactctctctaactttcatatctttgccacccttctaattcaaataccttctattctaaaaataatggtggctggtggtgcgaagatgg |
5745515 |
T |
 |
| Q |
153 |
aacatccatccgcatcagctccggtccttgttctctcggcggtgatttcgcaggaaggttgtgttcatggc |
223 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
5745516 |
aacatccatccgcatcacctccggtccttgttctcttggcggtgatttcgccggaagtctgtgttcatggc |
5745586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 163
Target Start/End: Original strand, 12792820 - 12792854
Alignment:
| Q |
129 |
tggtggctggtggtgcgaagatggaacatccatcc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
12792820 |
tggtggctggtggtgcgaagatggaacagccatcc |
12792854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 129 - 218
Target Start/End: Original strand, 15049493 - 15049582
Alignment:
| Q |
129 |
tggtggctggtggtgcgaagatggaacatccatccgcatcagctccggtccttgttctctcggcggtgatttcgcaggaaggttgtgttc |
218 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||| ||| ||| ||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
15049493 |
tggtggctgaaggtgcgaagatggaacaaccatccgcatcacctctagtcactgttctctcggcgctgatttcgcagaaagaatgtgttc |
15049582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 202
Target Start/End: Original strand, 26841440 - 26841513
Alignment:
| Q |
129 |
tggtggctggtggtgcgaagatggaacatccatccgcatcagctccggtccttgttctctcggcggtgatttcg |
202 |
Q |
| |
|
||||||||| ||||||||| |||||||| |||||||||||| | | |||| | ||||||||||| |||||||| |
|
|
| T |
26841440 |
tggtggctgatggtgcgaatatggaacagccatccgcatcaccactggtcactattctctcggcgttgatttcg |
26841513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University