View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_low_66 (Length: 206)
Name: NF20553_low_66
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 10690165 - 10689989
Alignment:
| Q |
14 |
cagcagcagcaggtatcgacatgggacaagcattgaaaggactagcctcacttgttgattcagcagcacctaccattgccggagaaaattccttctctgg |
113 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
10690165 |
cagcaacatcaggtattgacatgggacaagcattgaaaggactagcctcacttgttaattcagcagtacctaccattgcacgagaaaattccttctctgg |
10690066 |
T |
 |
| Q |
114 |
ttgccatattaatatacctggtaaggatgctcctttggatcttactttaaaaaccagtatgcgaatagtattctcct |
190 |
Q |
| |
|
|| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10690065 |
atgtcatattaatatacctggcaagaatgctcctttggatcttactttaaaaaccagtatgcaaatagtattctcct |
10689989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 43554060 - 43554117
Alignment:
| Q |
127 |
atacctggtaaggatgctcctttggatcttactttaaaaaccagtatgcgaatagtat |
184 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554060 |
atacctggcaagaaggctcctttggatcttactttaaaaaccagtatgcgaatagtat |
43554117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University