View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20554_high_13 (Length: 287)

Name: NF20554_high_13
Description: NF20554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20554_high_13
NF20554_high_13
[»] chr2 (2 HSPs)
chr2 (7-163)||(44430375-44430527)
chr2 (216-287)||(44430248-44430319)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 44430527 - 44430375
Alignment:
7 gcagcacagaccccacttgaagaaaagttttgtttgtttatacatacatatgagaaacaacataagtccaaaggctagactttctcttaagcataatgac 106  Q
    |||||||| |||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||    
44430527 gcagcacaaaccccacttgaagaaaagttttgtttgtttatacata----tgagaaacaacataagtccaaaggctagactttctcttaagcataatgac 44430432  T
107 aaaataatagtaatgatgataatgataatagcatatcttctttgtaacacatttagg 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44430431 aaaataatagtaatgatgataatgataatagcatatcttctttgtaacacatttagg 44430375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 44430319 - 44430248
Alignment:
216 catcatcacaatgaaattatcttatgtctaaattattaatataaattctgcatatcttttattttgtcagta 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44430319 catcatcacaatgaaattatcttatgtctaaattattaatataaattctgcatatcttttattttgtcagta 44430248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University