View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20554_high_13 (Length: 287)
Name: NF20554_high_13
Description: NF20554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20554_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 44430527 - 44430375
Alignment:
| Q |
7 |
gcagcacagaccccacttgaagaaaagttttgtttgtttatacatacatatgagaaacaacataagtccaaaggctagactttctcttaagcataatgac |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44430527 |
gcagcacaaaccccacttgaagaaaagttttgtttgtttatacata----tgagaaacaacataagtccaaaggctagactttctcttaagcataatgac |
44430432 |
T |
|
| Q |
107 |
aaaataatagtaatgatgataatgataatagcatatcttctttgtaacacatttagg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44430431 |
aaaataatagtaatgatgataatgataatagcatatcttctttgtaacacatttagg |
44430375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 216 - 287
Target Start/End: Complemental strand, 44430319 - 44430248
Alignment:
| Q |
216 |
catcatcacaatgaaattatcttatgtctaaattattaatataaattctgcatatcttttattttgtcagta |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44430319 |
catcatcacaatgaaattatcttatgtctaaattattaatataaattctgcatatcttttattttgtcagta |
44430248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University