View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20554_high_14 (Length: 278)
Name: NF20554_high_14
Description: NF20554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20554_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 21186756 - 21186513
Alignment:
| Q |
14 |
atatctctcgttcattatgatcatgatttattttgttgcttgttatagtactaatttgcaagaggacccacttagttcaattgttgagaattcgccttat |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21186756 |
atatctctcattcattatgatcatgatttattttgttgcttgttatagtactaatttgcaagaggacccacttagttcaattgttgtgaattcgccttat |
21186657 |
T |
 |
| Q |
114 |
ataaatgatggtggaacattcaaggattttctcatgcaaagtacagatcatgttttgagcttaaagagcaagttgggtgacacttctccttcatcgatta |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21186656 |
ataaatgatggtggaatattcaaggattttctcatgcaaagtacagatcatgttttgagcttaaagagcaagttgggtgacacttctccttcatcgatga |
21186557 |
T |
 |
| Q |
214 |
aaacctttaatgttgatcagtatggagctcaaggagatggtaaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21186556 |
aaacctttaatgttgatcagtatggagctcaaggagatggtaaa |
21186513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University