View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20554_high_18 (Length: 235)
Name: NF20554_high_18
Description: NF20554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20554_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 48155629 - 48155559
Alignment:
| Q |
4 |
ttgagagaaacgaattgaatcatatactcgactttgatgtactcaacgtttatttatgctttatatagtta |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48155629 |
ttgagagaaacgaattgaatcatatactcgactttgatgtactcaacatttatttatgctttatatagtta |
48155559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 79 - 143
Target Start/End: Original strand, 40192748 - 40192812
Alignment:
| Q |
79 |
atcagcaatgataacaggacacagaaaaattaacacaatacggacaccatatgtctatacgggta |
143 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
40192748 |
atcaacaatgataacaggacacagaaaaactaacacaatacggacaccgtatgtctatacgggta |
40192812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University