View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20554_low_21 (Length: 201)
Name: NF20554_low_21
Description: NF20554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20554_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 8757412 - 8757572
Alignment:
| Q |
19 |
acagaatcaagggcgttgttgtgttttgctgttttgcttgagaaaggacctgaggctgtgcaatacaattccgcgatggcgttgatggagattactgctg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757412 |
acagaatcaagggcgttgttgtgtttttctgttttgcttgagaaaggaccggaggctgtgcaatacaattccgcgatggcgttgatggagattactgctg |
8757511 |
T |
 |
| Q |
119 |
tggctgagaaagatgctgaattgaggaaatctgcattcaagcctaattctcctgcctgcaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757512 |
tggctgagaaagatgctgaattgaggaaatctgcattcaagcctaattctcctgcctgcaa |
8757572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 143
Target Start/End: Complemental strand, 32031047 - 32030926
Alignment:
| Q |
22 |
gaatcaagggcgttgttgtgttttgctgttttgcttgagaaaggacctgaggctgtgcaatacaattccgcgatggcgttgatggagattactgctgtgg |
121 |
Q |
| |
|
||||||||||| ||||| ||||||||| || | ||||| ||||| ||||| | ||| | |||||||| || ||||||||| ||||||||||| |||| |
|
|
| T |
32031047 |
gaatcaagggctttgttatgttttgctattctacttgaaaaagggcctgaagaagtgaagtacaattctgctttggcgttgaaagagattactgcagtgg |
32030948 |
T |
 |
| Q |
122 |
ctgagaaagatgctgaattgag |
143 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
32030947 |
ctgagaaagatcctgaattgag |
32030926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University