View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20555_high_13 (Length: 389)
Name: NF20555_high_13
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20555_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 11 - 315
Target Start/End: Complemental strand, 31166451 - 31166147
Alignment:
| Q |
11 |
cagagaaaacagatcctatgatgctcaagttttgttcactatagaacctaacatcaaggtttggagttggaacaagtaagagatttgtgtcttgaggaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166451 |
cagagaaaacagatcctatgatgctcaagttttgctcactatagaacctaacatcaaggtttggagttggaacaagtaagagatttgtgtcttgaggaag |
31166352 |
T |
 |
| Q |
111 |
aatttcttcaacttttgaaggatttttgttggttagaattgttgtttcaaaccaaaaggaatctaacaacgttagaatttgttctgcagacattactttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166351 |
aatttcttcaacttttgaaggatttttgttggttagaattgttgtttcaaaccaaaaggaatctaacaacgttagaatttgttctgcagacattactttg |
31166252 |
T |
 |
| Q |
211 |
ttgtgtgtgacaagtgaatggtttgaaattggaatttggattctataaagatatgagaaggttggagagagttatatgtttgaagataagaagagaaatt |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166251 |
ttgtgtgtgacgagtgaatggtttgaaattggaatttggattctataaagatatgagaaggttggagagagttatatgtttgaagataagaagagaaatt |
31166152 |
T |
 |
| Q |
311 |
gtcaa |
315 |
Q |
| |
|
||||| |
|
|
| T |
31166151 |
gtcaa |
31166147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University