View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20555_high_21 (Length: 263)
Name: NF20555_high_21
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20555_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 7303585 - 7303350
Alignment:
| Q |
9 |
agaagcaaaggaagataaagaggaagtagtagcaattactggtgatgaaggagaagttgatgaagcnnnnnnntgcttgatgaaatcacttgctgatttg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7303585 |
agaagtaaaggaagataaagaggaagtagtagcaattactggtgatgaaggagaagttgatgaagcaaaaaaatgcttgatgaaatcacttgctgatttg |
7303486 |
T |
|
| Q |
109 |
gatattgttttggaggatattcggattctcaaagagagagtggaaaagatcaactttgatatgcaacctctggatgatagattgaagtctctcaaaagct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7303485 |
gatattgttttggaggatattcggattctcaaagagagagtggaaaagatcaactttgatatgcaacctctggatgatagattgaagtctctcaaaagct |
7303386 |
T |
|
| Q |
209 |
tgtgattgacaa-cacaggagggtaaattgaagtgt |
243 |
Q |
| |
|
|||||||| ||| | | ||||||||||||||||||| |
|
|
| T |
7303385 |
tgtgattggcaacctctggagggtaaattgaagtgt |
7303350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University