View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20555_low_19 (Length: 326)
Name: NF20555_low_19
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20555_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 319
Target Start/End: Original strand, 16512008 - 16512307
Alignment:
| Q |
20 |
acccatcgtctaatttagaaggtggtactttaattgtttgtcctatggcgttgttgggccagtggaaggtaagattcctctctaattaggccaattagaa |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16512008 |
acccatcgtctaatttagaaggtggcactttaattgtttgtcctatggcgttgttgggtcagtggaaggtaagattcctctctaactaggccaattagaa |
16512107 |
T |
 |
| Q |
120 |
aaagcatagttgnnnnnnn-atatatctcaactaatatttatgtgaaaggtaatttacaagtattcaaaatcttcaggatgaacttgaaacgcattcaaa |
218 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16512108 |
aa-gcatagttgttttttgtatatatctcaactaatatttatgtaaaaggtaatttacaagtattcaaaatcttcaggatgaacttgaaacgcactcaaa |
16512206 |
T |
 |
| Q |
219 |
accaggcagcatatccatatttgttcattatggtgggggaagaaccagtaatcctgatttgctgttagagtatgatgttgtcttgacaactgatgatgtc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
16512207 |
accaggcagcatatccatatttgttcattatggtgggggaagaaccagtaatcctgatttgctgttagactatgatgttgtcttgacaacttatggtgtc |
16512306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University