View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20555_low_23 (Length: 263)

Name: NF20555_low_23
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20555_low_23
NF20555_low_23
[»] chr2 (1 HSPs)
chr2 (9-243)||(7303350-7303585)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 7303585 - 7303350
Alignment:
9 agaagcaaaggaagataaagaggaagtagtagcaattactggtgatgaaggagaagttgatgaagcnnnnnnntgcttgatgaaatcacttgctgatttg 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
7303585 agaagtaaaggaagataaagaggaagtagtagcaattactggtgatgaaggagaagttgatgaagcaaaaaaatgcttgatgaaatcacttgctgatttg 7303486  T
109 gatattgttttggaggatattcggattctcaaagagagagtggaaaagatcaactttgatatgcaacctctggatgatagattgaagtctctcaaaagct 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7303485 gatattgttttggaggatattcggattctcaaagagagagtggaaaagatcaactttgatatgcaacctctggatgatagattgaagtctctcaaaagct 7303386  T
209 tgtgattgacaa-cacaggagggtaaattgaagtgt 243  Q
    |||||||| ||| | | |||||||||||||||||||    
7303385 tgtgattggcaacctctggagggtaaattgaagtgt 7303350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University