View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20555_low_27 (Length: 239)

Name: NF20555_low_27
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20555_low_27
NF20555_low_27
[»] chr8 (1 HSPs)
chr8 (18-239)||(9338687-9338908)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 9338908 - 9338687
Alignment:
18 cctagcccattatagaagtagatttccttctcttttgtaaatacatcatgcttgcaaaggggagataggagacatagtaataaacagataattgagttac 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9338908 cctagcccattatagaagtagatttccttctcttttgtaaatacatcatgcttgcaaaggggagataggagacatagtaataaacagataattgtgttac 9338809  T
118 cgaaatgagttgaggttttggagcatannnnnnngcagatagaagcatgtttctaaatgtcgcgaagagtcgagacttcagataacaaggtttttggtgc 217  Q
    |||||||||||||||||| ||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9338808 cgaaatgagttgaggtttcggagcatatttttttgcagatagaagcatgtttctaaatgtcgcgaagagtcgagacttcagataacaaggtttttggtgc 9338709  T
218 tgaattgcttaagggattagct 239  Q
    |||||||| |||||||||||||    
9338708 tgaattgcgtaagggattagct 9338687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University