View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20555_low_29 (Length: 208)
Name: NF20555_low_29
Description: NF20555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20555_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 53122664 - 53122752
Alignment:
| Q |
18 |
attctaagttagttgtggaagctttctccaatgtccttttggttccttggaggctaaggaatggttgggccaactgtttccgtcttttc |
106 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53122664 |
attctaagttagttgcggaatctttctacaatgtccttttggttccttggaggctaaggaatggttgggccaattgtttccgtcttttc |
53122752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University