View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_high_13 (Length: 402)
Name: NF20556_high_13
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_high_13 |
 | |
|
| [»] scaffold0449 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 4071 - 3685
Alignment:
| Q |
1 |
cagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4071 |
cagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaaaccctaatgctctgcccaacctg |
3972 |
T |
|
| Q |
101 |
aaccagctgccgcgcgataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaa |
200 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3971 |
gaccagccgccgcgccataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgctccaatatgtcattcctctcaaa |
3872 |
T |
|
| Q |
201 |
gatcttggcctctccactttcactataactatactctatctactctctactgttgttgctgccccc-tttgatgtatgtggctagcatgcatcttgttta |
299 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
3871 |
gatcttggcctctccactttcactacaactatactctatctactctctactgttgttgctgcccccttttgatgtatgtggctagcatgcaacttgttta |
3772 |
T |
|
| Q |
300 |
tttactcagtatcattgttattttcatttatatatgcagattgttcctttgatatttgtactactatgttctatttcctcttctaag |
386 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3771 |
tttacccagtatcattgttattttcatttatatatgcagattgttccttagatatttgtactactatgttctatttcctcttctaag |
3685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University