View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_high_19 (Length: 332)
Name: NF20556_high_19
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 109 - 327
Target Start/End: Original strand, 47353650 - 47353868
Alignment:
| Q |
109 |
ttggtagtgcttatggtagcaggtatcggttgtcaaggatcacatttcaaggagtggaatttgatagtaaggagaaaagtgatagcatggagttgtcaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47353650 |
ttggtagtgcttatggtagcaggtatcggttgtcaaggatcacatttcaaggagtggaatttgatagtaaggagaaaagtgatagcatggagttgtcaaa |
47353749 |
T |
 |
| Q |
209 |
atccagtccagaagtaagaaattcacgataggatctgtgtcattgcaccttcaagttaatgtagattgctacctattactagtctgccatgaacagggtt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47353750 |
atccagtccagaagtaagaaattcacgataggatctgtgtcattgcaccttcaagttaatgtagattgctacctattactggtctgccatgaacagggtt |
47353849 |
T |
 |
| Q |
309 |
gcatggccctatgcctatg |
327 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47353850 |
gcatggccctatgcctatg |
47353868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 47353533 - 47353629
Alignment:
| Q |
16 |
aaaatgactattatttgtaaggttcaaagtttattttaacatttcatatcaataaatatgttcaatttcattttgaaggtggaggctgtggtgttgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47353533 |
aaaatgactattatttgtaaggttcaaagtttattttaacatttcatatcaataaatatgttcaatttcattttgaaggtggaggctgtggtgttgg |
47353629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University