View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_high_35 (Length: 212)
Name: NF20556_high_35
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 2838055 - 2837997
Alignment:
| Q |
31 |
taagtggatgatggtggaaagaatgatgggggagacaaaaagattaaaaagaaagttcg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2838055 |
taagtggatgatggtggaaagaatgatgggggagacaaaaagattaaaaagaaagttcg |
2837997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University