View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20556_low_26 (Length: 277)

Name: NF20556_low_26
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20556_low_26
NF20556_low_26
[»] chr3 (1 HSPs)
chr3 (18-240)||(51573491-51573714)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 51573491 - 51573714
Alignment:
18 gatatgattatataggattttcttattgtaaccttcttttttcttctcaggatttgaagtagtttacactgccgccaaggctttgttgtagttcaataac 117  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51573491 gatatgattatctaggattttcttattgtaaccttcttttttcttctcaggatttgaagtagtttacactgccgccaaggctttgttgtagttcaataac 51573590  T
118 ggttatttaaggcttctaacatgtcaaactgtttatct-actctgaatctgattatgatgatgaacctgtgagaggaaagaagttattgtcaactttcaa 216  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51573591 ggttatttaaggcttctaacatgtcaaactgtttatctgactctgaatctgattatgatgatgaacctgtgagaggaaagaagttattgtcaactttcaa 51573690  T
217 tttgggaacatgtagtaataataa 240  Q
    ||||||||||||||||||||||||    
51573691 tttgggaacatgtagtaataataa 51573714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University