View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_low_29 (Length: 252)
Name: NF20556_low_29
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 19921702 - 19921913
Alignment:
| Q |
19 |
agtagttctctagaaggagttcaatgttagattgaaattagttaacatatcaaatgatctatcttcttcgcgtcagatatgattaatctagacctgccaa |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19921702 |
agtagttctctaggaggagttcaatgttagattgaaattagttaacatattgaatgatctatcttcttcgcgtcagatatgattaatctagacctgtcaa |
19921801 |
T |
 |
| Q |
119 |
ttcatgttattgagatcacaaatgtgcttgatcaaggtagaaacattttcattatcattgtaatttct--tgtgaccatatagactaacaccttcaaatc |
216 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19921802 |
ttcatgttattgagataaaaaatgtgcttgatcaaggtagaaacattttcattttcatcgtaatttcttatgtgaccatatagactaacaccttcaaatc |
19921901 |
T |
 |
| Q |
217 |
actttcaacttg |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19921902 |
actttcaacttg |
19921913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 119 - 228
Target Start/End: Complemental strand, 44520167 - 44520059
Alignment:
| Q |
119 |
ttcatgttattgagatcacaaatgtgcttgatcaaggtagaaacattttcattatcattgtaatttcttgtgaccatatagactaacaccttcaaatcac |
218 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||| ||| | |||| ||||| ||||||| ||||||| ||| | | |||| |||||||||||||| |
|
|
| T |
44520167 |
ttcatgttcttgaggtcacagatgtgcttgatcaacatagtgatatttccattaaaattgtaacttcttgttaccgtgtcgact-acaccttcaaatcaa |
44520069 |
T |
 |
| Q |
219 |
tttcaacttg |
228 |
Q |
| |
|
|||| ||||| |
|
|
| T |
44520068 |
tttctacttg |
44520059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University