View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_low_30 (Length: 246)
Name: NF20556_low_30
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 41014047 - 41013915
Alignment:
| Q |
1 |
aaaaacgatgatcacgtgaaacctgaactgcgcataaaactgcttgttcaatgggtcgagtttgctgttctctaattgagttctccaatttgttatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014047 |
aaaaacgatgatcacgtgaaacctgaactgcgcataaaactgtttgttcaatgggtcgagtttgctgttctctaattgagttctccaatttgttatgtga |
41013948 |
T |
 |
| Q |
101 |
atggataaaacaaacagtggttaagttagtgtc |
133 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
41013947 |
atggataaaacaaacagtggttgagttagtgtc |
41013915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 130 - 236
Target Start/End: Original strand, 41014153 - 41014259
Alignment:
| Q |
130 |
tgtcacaagtccagaaatatacctcgtagaccataccaagttagaggacatattaaaagttaaaattacactatcaatatgaaagcaagttaaactaata |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41014153 |
tgtcacaagtccagaaatatacctcgtagaccataccaagttaaaggacatattaaaagttaaaattacacgatcaatatgaaagcaagttaaactaata |
41014252 |
T |
 |
| Q |
230 |
tgtgatg |
236 |
Q |
| |
|
||||||| |
|
|
| T |
41014253 |
tgtgatg |
41014259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University