View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_low_34 (Length: 232)
Name: NF20556_low_34
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 19921702 - 19921897
Alignment:
| Q |
19 |
agtagttctctagaaggagttcaatgttagattgaaattagttaacatatcaaatgatctatcttcttcgcgtcagatatgattaatctagacctgccaa |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19921702 |
agtagttctctaggaggagttcaatgttagattgaaattagttaacatattgaatgatctatcttcttcgcgtcagatatgattaatctagacctgtcaa |
19921801 |
T |
|
| Q |
119 |
ttcatgttattgagatcacaaatgtgcttgatcaaggtagaaacattttcattatcattgtaatttct--tgtgaccatatagactaacaccttca |
212 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19921802 |
ttcatgttattgagataaaaaatgtgcttgatcaaggtagaaacattttcattttcatcgtaatttcttatgtgaccatatagactaacaccttca |
19921897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University