View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20556_low_9 (Length: 453)
Name: NF20556_low_9
Description: NF20556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20556_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 326 - 434
Target Start/End: Original strand, 38097247 - 38097355
Alignment:
| Q |
326 |
attattgatgactctacttagagtcatttatctaattgcaacaacttagaggttgtattcactaggcgacaaactaatgatagtactcctgctttggcac |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38097247 |
attattgatgactctacttagagtcatttatctaattgcaacaacttagaggttgtattcactaggcgacaaactaatgatagtactcctgctttggcac |
38097346 |
T |
 |
| Q |
426 |
aaacttctt |
434 |
Q |
| |
|
||||||||| |
|
|
| T |
38097347 |
aaacttctt |
38097355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 152 - 279
Target Start/End: Original strand, 38097020 - 38097152
Alignment:
| Q |
152 |
tctagtctaggtagaatatgtaatgagtacactagcaattataggttgatgcatgtaatattaatttctcttcaaatctcgatt-----tcatcttattt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
38097020 |
tctagtctaggtagaatatgtaatgagtacactagcaattataggttgatgcatgtaatattaatttcttttcaaatcccgatttcatctcatcttattt |
38097119 |
T |
 |
| Q |
247 |
agtaaagtgcatttgtgaccttaatgcaagcct |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
38097120 |
agtaaagtgcatttctgaccttaatgcaagcct |
38097152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 38096840 - 38096967
Alignment:
| Q |
1 |
gaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaannnnnnnnagtgaaagagaaatgcataccgcttatgaaatcatccaaagagagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096840 |
gaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaaggggg---agtgaaagagaaatgcataccgcttatgaaatcatccaaagagagta |
38096936 |
T |
 |
| Q |
101 |
ggaaatgatggtgatctggtctggtctggtc |
131 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
38096937 |
ggaaatgatggtgatctggtatggtctggtc |
38096967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University