View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20557_high_14 (Length: 272)
Name: NF20557_high_14
Description: NF20557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20557_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 77 - 256
Target Start/End: Complemental strand, 10365864 - 10365685
Alignment:
| Q |
77 |
gaagatctttcttttagtccatgacaaaaatattgaaatttaatttagctcatcgtagtaaaaatgtaatttttagttctcacaaaactaaatcgaaaca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
10365864 |
gaagatctttcttttagtccatgacaaaaatattgaaacttaatttgactcatcatagtaaaaatgtaacttttagtcctcacaaaaataaatcgaaaca |
10365765 |
T |
 |
| Q |
177 |
ctttagtccttaattgaacctttatcgagaaatttgannnnnnnngtcgatatgcgatactttcgtccaatgtgaaagtt |
256 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
10365764 |
ctttagtccttaattgaacctctatcgagaaatttgattttttttgtcaatatgtgatacttttgtccaatgtgaaagtt |
10365685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University