View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20557_high_14 (Length: 272)

Name: NF20557_high_14
Description: NF20557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20557_high_14
NF20557_high_14
[»] chr8 (1 HSPs)
chr8 (77-256)||(10365685-10365864)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 77 - 256
Target Start/End: Complemental strand, 10365864 - 10365685
Alignment:
77 gaagatctttcttttagtccatgacaaaaatattgaaatttaatttagctcatcgtagtaaaaatgtaatttttagttctcacaaaactaaatcgaaaca 176  Q
    |||||||||||||||||||||||||||||||||||||| |||||||  |||||| |||||||||||||| ||||||| ||||||||| ||||||||||||    
10365864 gaagatctttcttttagtccatgacaaaaatattgaaacttaatttgactcatcatagtaaaaatgtaacttttagtcctcacaaaaataaatcgaaaca 10365765  T
177 ctttagtccttaattgaacctttatcgagaaatttgannnnnnnngtcgatatgcgatactttcgtccaatgtgaaagtt 256  Q
    ||||||||||||||||||||| |||||||||||||||        ||| ||||| |||||||| ||||||||||||||||    
10365764 ctttagtccttaattgaacctctatcgagaaatttgattttttttgtcaatatgtgatacttttgtccaatgtgaaagtt 10365685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University