View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20557_high_15 (Length: 269)
Name: NF20557_high_15
Description: NF20557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20557_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 42003084 - 42002836
Alignment:
| Q |
20 |
ccaaactacttgatcaacaaaggagatgcgtttcacaacaaagctttcagaatttggaagagtgagtaagggttcactgaaggtggtg---------ttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42003084 |
ccaaactacttgatcaacaaaggagatgcgtttcacaacaaagctttcagaatttggaagagtgagtaagggttcactgaaggtggtggtggtggtgttg |
42002985 |
T |
 |
| Q |
111 |
gtgcacgtgaggtcgaaacctgggtaactacaaagattggtttgatttgattggtttaatgaaaacggaaaccaaattggaagtccgtaggtttcgcatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42002984 |
gtgcacgtgaggtcgaaacctgggtaactacaaagattggtttgatttgattggtttaatgaaaacggaaaccgaattggaagtccgtaggtttcgcatg |
42002885 |
T |
 |
| Q |
211 |
atgttgtcctttcacaagtgaagaacttttcaccttttgttgttctgtg |
259 |
Q |
| |
|
||| |||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
42002884 |
atgctgtcctttcacatgtgaagaactcttcaccttttgttgttctgtg |
42002836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University