View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20557_low_14 (Length: 276)
Name: NF20557_low_14
Description: NF20557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20557_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 276
Target Start/End: Complemental strand, 33600384 - 33600113
Alignment:
| Q |
4 |
tggaggatttagagcgcatgtgtacttgaattgtcgagaagtaagatattgtatatataattccttttaaattatgaatgaataaaacctatgcctatat |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600384 |
tggaggatttagagcgcatgtgtactcgaattgtcgagaagtaagatattgtatatataattccttttaaattatgaatgaataaaacctatgcctatat |
33600285 |
T |
 |
| Q |
104 |
ttgacnnnnnnnnngtttgttttaaaacttaattttggtcttggattgtttaagatctctaacgagaaccagcctgcttgacttattgataggttgataa |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33600284 |
ttgactttttttt-gtttgttttaaaacttaattttggtcttggattgtttatgatctctaacgagaactagcctgcttgacttattgataggttgataa |
33600186 |
T |
 |
| Q |
204 |
ctacttgattttgcttgacttttgaatttaataattgatggccattttgtcaaacacatgcttatctgttcat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600185 |
ctacttgattttgcttgacttttgaatttaataattgatggccattttgtcaaacacatgcttatctgttcat |
33600113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University