View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20557_low_21 (Length: 248)
Name: NF20557_low_21
Description: NF20557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20557_low_21 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 343579 - 343818
Alignment:
| Q |
1 |
tttccaattaactttggttggctcagatcaacataaacatagcttggcatagctgagaaatgaaggctttaccttactagtagaaaataaaggattatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343579 |
tttccaattaactttggttggctcagatcaacataaacatagcttggcatagctgagaaatgaaggctttaccttactagtagaaaataaaggattatct |
343678 |
T |
|
| Q |
101 |
aatgatgattgatgataatggtagtagtagcaataatatttgatagagccatgaaacaaaatgtcaatattgtactatgtctcttcattgattatatacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343679 |
aatgatgattgatgataatggtagtagtaacaataatatttgatagagccatgaaacaaaatgtcaatattgtactatgtctcttcattgattatatacc |
343778 |
T |
|
| Q |
201 |
acagcacccatacaacaaagtgttgcttctcattcttctc |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
343779 |
acagcacccacacaacaaagtgttgcttctcattcttctc |
343818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University