View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20559_high_28 (Length: 255)
Name: NF20559_high_28
Description: NF20559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20559_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 21273060 - 21272927
Alignment:
| Q |
1 |
atgtaacgcttggaaattgcttagaactatcatagattcagattttgactaaatattgaaatgaatatccccacatgattattgcaaagactattgtcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21273060 |
atgtaacgcttggaaattgcttagaactatcatagattcagattttgactaaatattgaaatgaatagccccacatgattattgcaaagactattgtcca |
21272961 |
T |
 |
| Q |
101 |
attcaaattacaataaattatgtcatctctataa |
134 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
21272960 |
attcaaattacaataaattatgccatctctataa |
21272927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 21272869 - 21272822
Alignment:
| Q |
192 |
gtatccgatatttgtccacattaacaatcggaggatcaagcaaatttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21272869 |
gtatccgatatttgtccacattaacaatcggaggatcaagcaaatttg |
21272822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University