View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20559_high_30 (Length: 245)
Name: NF20559_high_30
Description: NF20559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20559_high_30 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 144657 - 144428
Alignment:
| Q |
11 |
agcttccatattctcccactcactctccttccccttaagctgctccgccgcaggagccgaagcggaaccaccggcggtcgaagaattcgcggcggcggag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
144657 |
agcttccatattctcccactcactctccttccccttaagctgctccgccgcgggagcagaagcggaaccaccggcggtcgaagaattcgcggcggcggag |
144558 |
T |
 |
| Q |
111 |
gtattgttagggatttgaatatgaatatggatatttgttattagatcatggttttttgtgttgcagtaggaggaaagtgttcttggaggcgtgaaccatt |
210 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
144557 |
gaattgttagggatttgaatttgaatatggatatttgttattagatcatggttttttgtgttgcagtaggaggaaagtattcttggaggcgtgaaccatt |
144458 |
T |
 |
| Q |
211 |
cttcttcaaacccattcttcttcatttcac |
240 |
Q |
| |
|
|||||||||||||||||||| || |||||| |
|
|
| T |
144457 |
cttcttcaaacccattcttcctcttttcac |
144428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 26258940 - 26258875
Alignment:
| Q |
63 |
ggagccgaagcggaaccaccggcggtcgaagaattcgcggcggcggaggtattgttagggatttga |
128 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26258940 |
ggagcagaagcagaaccaccagcggtcgaagaattcgcggcggcggaggaattgttagggatttga |
26258875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 26259044 - 26258984
Alignment:
| Q |
1 |
cttcaatctcagcttccatattctcccactcactctccttccccttaagctgctccgccgc |
61 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26259044 |
cttcaatttcagcttccatactctcccactcactctccttcttcttaagctgctccgccgc |
26258984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University