View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20559_low_9 (Length: 459)
Name: NF20559_low_9
Description: NF20559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20559_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 13 - 315
Target Start/End: Original strand, 38348437 - 38348739
Alignment:
| Q |
13 |
gagatgaagatgaaagttcacaaaggaaaaagtgaagctgccagcatgatctaaactttggttagagagctttcttttgaatggaaagaagagagagtaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348437 |
gagatgaagatgaaagttcacaaaggaaaaagtgaagctgccagcatgatctaaactttggttagagagctttcttttgaatggaaagaagagagagtaa |
38348536 |
T |
|
| Q |
113 |
gtaaccctaaccttgactaggtcatgctgtgacagcctcactctttcctattttgtggaccaagttcctaatcctaacgatctcttcaacatactgaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348537 |
gtaaccctaaccttgactaggtcatgctgtgacagcctcactctttcctattttgtggaccaagttcctaatcctaacgatctcttcaacatactgaaag |
38348636 |
T |
|
| Q |
213 |
acgcacaacaaactttaaacctaaaaggtgagtgaaattactgttagaagaagcatctctcgtttattcctttcttagtttctgttatgttctggcaggc |
312 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348637 |
acacacaacaaactttaaacctaaaaggtgagtgaaattactgttagaagaagcatctctcgtttattcctttcttagtttctgttatgttctggcaggc |
38348736 |
T |
|
| Q |
313 |
gtg |
315 |
Q |
| |
|
||| |
|
|
| T |
38348737 |
gtg |
38348739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 380 - 442
Target Start/End: Original strand, 38348804 - 38348866
Alignment:
| Q |
380 |
catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttat |
442 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348804 |
catgccaacctggttttactgtttcttgttgactcttaatttctatgaatagtatatttttat |
38348866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 31573399 - 31573364
Alignment:
| Q |
30 |
tcacaaaggaaaaagtgaagctgccagcatgatcta |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573399 |
tcacaaaggaaaaagtgaagctgccagcatgatcta |
31573364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 165
Target Start/End: Complemental strand, 31573108 - 31573063
Alignment:
| Q |
120 |
taaccttgactaggtcatgctgtgacagcctcactctttcctattt |
165 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31573108 |
taaccctgactaggtcatgctgtgctagcctcactccttcctattt |
31573063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University