View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2055_low_2 (Length: 240)
Name: NF2055_low_2
Description: NF2055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2055_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12366027 - 12365805
Alignment:
| Q |
1 |
tagtagtaaaaacaaaaacataactattcatgcacattgctattatgcaagacaagttttttacacctatgccatcttggaaatgacttattgaactctt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| || |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
12366027 |
tagtagtaaaaacaaaaatataactattcatgcacattgctattatgcaagacacgttattgacacacatgccatcttggaaatgacttattggactctt |
12365928 |
T |
 |
| Q |
101 |
atatgacatattagtctttgaatataggctcgtgacttgaggacgggtttggatcagatgaagagtagtagctctgctatgagaagtagctcctagactg |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |||| |||||||||||| ||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
12365927 |
atatgacatattagtctttgaagatagactcgtgacttggggacatgtttggatcagacgaagagtagtagcagtcctctgagaagtagctcctagactg |
12365828 |
T |
 |
| Q |
201 |
gcgtgactcatactgccagctgt |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
12365827 |
gcatgactcatactgccagctgt |
12365805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 19965716 - 19965782
Alignment:
| Q |
7 |
taaaaacaaaaacataactattcatgcacattgctattatgcaagacaagttttttacacctatgcc |
73 |
Q |
| |
|
|||||||||| | | ||||| || | || ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
19965716 |
taaaaacaaatatacaactaatcgtacatattgctattatgcaagacacgtttttgacacctatgcc |
19965782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University