View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2055_low_3 (Length: 201)
Name: NF2055_low_3
Description: NF2055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2055_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 34539976 - 34540144
Alignment:
| Q |
17 |
catgaaacaaggaatgggtcaactgccttttcagtgaagagcaaagcactcgctgcataccgtagcaacctttgctttagaccagattcatatattaggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34539976 |
catgaaacaaggaatgggtcaactgccttttcagtgaagagcaaagcactcgctgcataccgtagcaacctttgctttagaccagattcatatattaggc |
34540075 |
T |
 |
| Q |
117 |
tgcaaaagcaatggaaaatagtgcaggataaattaattaaaattttatcaagaaaactatagttgaggg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34540076 |
tgcaaaagcaatggaaaatagtgcaggataaattaattaaaattttatcaagaaaactatagttgaggg |
34540144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University