View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20560_low_5 (Length: 287)
Name: NF20560_low_5
Description: NF20560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20560_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 31805301 - 31805432
Alignment:
| Q |
129 |
aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagatatgtaacggacgtaaaaaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31805301 |
aaaggcaatattaattcataatcatttctatttagtactagatatgtaaccaaatatatgataatcaatatgtaatagacatgtaacggacgtaaaaaat |
31805400 |
T |
 |
| Q |
229 |
tatttggttgaatgtcaagaagagaagtgggg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31805401 |
tatttggttgaatgtcaagaagagaagtgggg |
31805432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University