View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20561_high_18 (Length: 227)
Name: NF20561_high_18
Description: NF20561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20561_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 1959931 - 1960131
Alignment:
| Q |
1 |
cttgtgctataaaagcttgcaactgatactcttggaccgacatgatttgctaccactctgtgctcaagcacaaacacttcaaatgatcacgagggattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1959931 |
cttgtgctataaaagcttgcaactgatactcttggaccgacatgatttgctaccactctgtgctcaagcacaaacacttcaaatgatcacgagggattga |
1960030 |
T |
|
| Q |
101 |
ctgcatgttgcaaaagatggtgattctgttaaaggaggggatctatctctgagctgatgtactcaaatattttggtgtgcttggataagattgctccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1960031 |
ttgcatgttgcaaaagatggtgattctgttaaaggcggggatcta----------------------tattttggtgtgctttgataagattgctccaaa |
1960108 |
T |
|
| Q |
201 |
gaagtaaaagaagttttgaattg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1960109 |
gaagtaaaagaagttttgaattg |
1960131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 2023394 - 2023328
Alignment:
| Q |
1 |
cttgtgctataaaagcttgcaactgatactcttggaccgacatgatttgctaccactctgtgctcaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023394 |
cttgtgctataaaagcttgcaactgatactcttggaccgacatgatttgctaccactctgtgctcaa |
2023328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 83 - 222
Target Start/End: Original strand, 5896692 - 5896835
Alignment:
| Q |
83 |
atgatcacgagggattgactgcatgttgcaaaagat--ggtgattctgttaaaggaggggatctatctct--gagctgatgtactcaaatattttggtgt |
178 |
Q |
| |
|
|||||||| | ||||| | |||||| ||||||||| |||||||| |||||||||||||||| |||||| | || |||||||||||||||||||||| |
|
|
| T |
5896692 |
atgatcacaacggattaattgcatgctgcaaaagactgggtgattcagttaaaggaggggatccatctctttgggcggatgtactcaaatattttggtga |
5896791 |
T |
|
| Q |
179 |
gcttggataagattgctccaaagaagtaaaagaagttttgaatt |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5896792 |
gcttggagaagattgctccaaagaagtaaaagaagttttgaatt |
5896835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University