View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20561_high_5 (Length: 403)
Name: NF20561_high_5
Description: NF20561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20561_high_5 |
 |  |
|
| [»] scaffold0172 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0172 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 384
Target Start/End: Original strand, 17211 - 17606
Alignment:
| Q |
5 |
cagaccacatcacatttttaaaatggatgaacaaatcgagtcaatcacaaaacaggttcacaactcataatagcnnnnnnnnnnnngaaattaccagcca |
104 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17211 |
cagaccacatcacgtttttaaaatggatgaacaaatcaactcaatcacaaaacaggttcacaactcataatagcaaaaataaaaaagaaattaccagcca |
17310 |
T |
 |
| Q |
105 |
tggaatagcaaaaagagcagtgttatttccagcaatgagatttctggcattaagtaaaatttgaggcatttgaagtaacaggaaagggagattggctgct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17311 |
tggaatagcaaaaagagcagtgttatttccagcaatgagatttctggcattaagtaaaatttgaggcatttgaagtaacaggaaagggagattggctgct |
17410 |
T |
 |
| Q |
205 |
ccagagaattttgatgtaagtgaatcccattgctcatagtcatatctgctttcatttcccttnnnnnnnnnnnnnnnnnnntgtgattaaattcttcaat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
17411 |
ccagagaattttgatgtaagtgaatcccattgctcatagtcatatcttctttcatttcccttcaaacaaaacaaaacaaaatgtgattaaattcttcaat |
17510 |
T |
 |
| Q |
305 |
tattgtgaat----------------gtgagtgtaggtacgtacctggtgaggtggatcagaatgaagagcattgagaataaaattgggtcggcgt |
384 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17511 |
tattgtgagtgtgagtgtgagtgtgagtgagtgtaggtacgtacctggtgaggtggatcagaatgaagagcattgagaataaaattgggtcggcgt |
17606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University