View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20561_high_7 (Length: 366)
Name: NF20561_high_7
Description: NF20561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20561_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 350
Target Start/End: Original strand, 11696835 - 11697172
Alignment:
| Q |
13 |
aatatgtcggagaagaatagattttcttacactgtaatgatatctggtcttgcgattcatggacgtggtaaggaagctcttaaagttttctcagaaatga |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696835 |
aatatgtcggagaagaatagatattcttacactgtaatgatatctggtcttgcgattcatggacgtggtaaggaagctcttaaagttttctcagaaatga |
11696934 |
T |
 |
| Q |
113 |
ttgaagaaggtttggcaccagatgatgttgtctatgttggcgtatttagtgcttgcagtcatgctggtcttgtcgaggagggtctacaatgtttcaaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696935 |
ttgaagaaggtttggcaccagatgatgttgtctatgttggcgtatttagtgcttgcagtcatgctggtcttgtcgaggagggtctacaatgtttcaaaag |
11697034 |
T |
 |
| Q |
213 |
catgcaatttgagcatacgattgaaccaacagttcagcattatggttgcatggtggatctgttgggaagatttgggatgctaaaggaagcctatgaactc |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697035 |
catgcaatttgagcataagattgaaccaacggttcagcattatggttgcatggtggatctgttgggaagatttgggatgctaaaggaagcctatgaactc |
11697134 |
T |
 |
| Q |
313 |
ataaagagcatgtcaatcaagcctaatgatgtaatttg |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697135 |
ataaagagcatgtcaatcaagcctaatgatgtaatttg |
11697172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University