View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20562_high_29 (Length: 210)
Name: NF20562_high_29
Description: NF20562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20562_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 120 - 192
Target Start/End: Complemental strand, 30713869 - 30713797
Alignment:
| Q |
120 |
cggtaaatagggacaactaatttaaaacggatagagtatttttcactatttacgcactcgtttatacgtaggt |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30713869 |
cggtaaatagggataactaatttaaaacggatagagtatttctcactatttacgcactcgtttatacgtaggt |
30713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 192
Target Start/End: Complemental strand, 30732165 - 30732095
Alignment:
| Q |
122 |
gtaaatagggacaactaatttaaaacggatagagtatttttcactatttacgcactcgtttatacgtaggt |
192 |
Q |
| |
|
||||||| ||| |||||||| ||||| ||||| || || |||||||||||||||||| ||||||||||| |
|
|
| T |
30732165 |
gtaaataaggataactaattaaaaacatatagaatagttctcactatttacgcactcgcatatacgtaggt |
30732095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University