View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20562_low_18 (Length: 283)
Name: NF20562_low_18
Description: NF20562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20562_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 6 - 263
Target Start/End: Complemental strand, 20530907 - 20530650
Alignment:
| Q |
6 |
agttataagcgattaaagcttgaaaaaggattgagcaggaagatgagaaatgtagttgcttgtgaagggagggatcgtgttgaaaggtgtgaagtttttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20530907 |
agttataagcgattaaagcttgaaaaaggattgagcaggaagatgagaaatgtagttgcttgtgaagggagggatcgtgttgaaaggtgtgaagtttttg |
20530808 |
T |
 |
| Q |
106 |
ggaagtggcgtgcacgcatgagcatggctgggtttaggttaaacccgatgagtcggaaagttactgagtcaataacttcaagactcatccaaggtagtag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20530807 |
ggaagtggcgtgcacgcatgagcatggctgggtttaggttaaacccgatgagtcggaaagttactgagtcaataacttcaagactcattcaaggtagtag |
20530708 |
T |
 |
| Q |
206 |
aattactgtgcatgaagagaatggtggagtttgctttggttggaagggaaaaactctc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20530707 |
aattactgtgcatgaagagaatggtggagtttgctttggttggaagggaaaagctctc |
20530650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 141
Target Start/End: Original strand, 17219575 - 17219658
Alignment:
| Q |
58 |
tagttgcttgtgaagggagggatcgtgttgaaaggtgtgaagtttttgggaagtggcgtgcacgcatgagcatggctgggttta |
141 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||||||| || ||||| ||| | ||||| ||||| ||||||| |
|
|
| T |
17219575 |
tagtggcttgtgaaggtagggatcgtgttgaaaggtgtgaggtttttggcaaatggcgcgcaaggatgagtatggcggggttta |
17219658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University