View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20562_low_22 (Length: 244)
Name: NF20562_low_22
Description: NF20562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20562_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 46910978 - 46911193
Alignment:
| Q |
13 |
tcatcaccagaaatttctttatgtataaaataaataaattatatcgacacctgcatttgcaatatcactcattttttatataaannnnnnnagagtaaaa |
112 |
Q |
| |
|
||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46910978 |
tcatcaccataaatttctttatctacaaaataaataaattatatcgacacctgcatttgcaatatcactcattttttatataaatttttttagagtaaaa |
46911077 |
T |
|
| Q |
113 |
ggatagtttgctatattactctttcctcttaataaaataccacatgcatttcacaatatccaacaatgcaatttttatatagaaaaatattttatctcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46911078 |
ggatagtttgctatattactctttcctcttaataaaataccacatgcatttcgcaatatccaacaatgcaatttttatatggaaaaatattttatctcat |
46911177 |
T |
|
| Q |
213 |
acttctctaacaaaat |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46911178 |
acttctctaacaaaat |
46911193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University