View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20562_low_25 (Length: 227)
Name: NF20562_low_25
Description: NF20562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20562_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 37852926 - 37852778
Alignment:
| Q |
1 |
ctaatatgatattattaatgaagcaaatcaaggtaaacgagtacttactagatgtttagtgaccaaaataactattatcaatatgtgtaaatgaaagaaa |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37852926 |
ctaatatgacattattaatgaagcaaatcaaggtaaacgagtacttactagatgtttagggatcaaaataactattatcaatatctgtaaatgaaagaaa |
37852827 |
T |
|
| Q |
101 |
tacattactccttgtcaacaaaagatagatagaattaccgaatttgcac |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37852826 |
tacattactccttgtcaacaaaagatagatagaattgccgaatttgcac |
37852778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University