View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_high_13 (Length: 251)
Name: NF20563_high_13
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 246
Target Start/End: Complemental strand, 34935897 - 34935746
Alignment:
| Q |
95 |
gcaagcacgacatattttgttataattggatcttcaaaaactttactagtgnnnnnnnatttactttccttaattactacttcaaaattatgtcttcaag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34935897 |
gcaagcacgacatattttgttataattggatcttcaaaaactttactagtgtttttttatttactttccttaattactacttcaaaattatgtcttcaag |
34935798 |
T |
|
| Q |
195 |
attgtggaattactggccccagccacactgacccttatggtgaacctttgct |
246 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34935797 |
attgtggaattactggccccagccaagtggacccttatggtgaacctttgct |
34935746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 34935994 - 34935931
Alignment:
| Q |
1 |
ttcaaaaaagttacacaatcatatgaaaaagttacaaatatgattgaaaagttacatattttgt |
64 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34935994 |
ttcaaaaaagttacacaatgatatgaaaaagttacaaatatgattgaaaagttacatattttgt |
34935931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University