View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20563_high_18 (Length: 216)

Name: NF20563_high_18
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20563_high_18
NF20563_high_18
[»] chr5 (1 HSPs)
chr5 (1-199)||(5139268-5139466)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 5139466 - 5139268
Alignment:
1 aaaaaacatcacgtcattagaaaaatttatgtggtaagattcctgtaatgtcgacattttgtgttactgagctgctggatgacccttggcacactcccac 100  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5139466 aaaaaacgtcacgtcattaaaaaaatttatgtggtaagattcctgtaatgtcgacattttgtgttactgagctgctggatgacccttggcacactcccac 5139367  T
101 agcatgtagtatcagagcccgtgtttgacttgacaagaagcgggatcctggtgtttggatgaaggataggtggtgggagctcccacttgagtggaaaat 199  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
5139366 agcatgtagtatcagagcccttgtttgacttgacaagaagcgggatcctggtgtttggatgaaggataggtggtgggagctcacacttgagtggaaaat 5139268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University