View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_high_19 (Length: 208)
Name: NF20563_high_19
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_high_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 44431157 - 44430950
Alignment:
| Q |
1 |
atcatccattcctaagcagcacagctaggagagagtctctaagagagaatctatgcttatttgtggatagtggccataaaataaagcaaatatttactga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44431157 |
atcatccattcctaagcagcacggctaggagagagtctctaagagagaatctatgcttatttgtggatagtggccataaaataaagcaaatatttactga |
44431058 |
T |
 |
| Q |
101 |
aaatacagaaagaaaagaataaccttagtttgtnnnnnnnngaaaatatcttttcacaatcatttgtttatgaatttctgcatgactgatggatgcccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44431057 |
aaatacagaaagaaaagaataaccttagtttgtaaaaaaaagaaaatatcttttcacaatcatttgtttatgaatttctgcatgattgatggatgcccat |
44430958 |
T |
 |
| Q |
201 |
taacttca |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
44430957 |
taacttca |
44430950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University